Molecular biology.....

RNA folding is the most essential process underlying RNA function

DEAD-box helicase Mss116p is essential for respiratory growth by acting as group I and group II intron splicing factor

Mss116p assists RNA folding

ai5γ group II intron

ai5γ ribozyme D135 achieves its complex architecture by following a direct path, in which formation of the scaffolding domain (D1) constitutes a compact intermediate on the way from the unfolded to the native conformation

A small substructure within D1, the κ–ζ element, was found to control D135 compaction and to initiate a cascade of folding events

Mss116p plays a role in mitochondrial translation and RNA processing

Mss116p influences the folding mechanism in another way: long exon sequences interfere with ai5γ splicing 

-------------
HDV ribozymes catalyze their own scission from the transcript during rolling circle replication of the hepatitis delta virus
Genomic mapping of these RNAs suggested several biological roles, one of which is the 5' processing of non-LTR retrotransposons

Mitochondrial DNA (mtDNA)...

The mitochondrion is a highly specialized organelle, present in almost all eukaryotic cells and principally charged with the production of cellular energy through oxidative phosphorylation

Somatic mutations in mtDNA are also linked to other complex traits, including neurodegenerative diseases, ageing and cancer.

The mtDNA genome mutations can lead to energy and respiratory-related disorders such as myoclonic epilepsy with ragged red fiber disease, mitochondrial myopathy, encephalop

athy, lactic acidosis and stroke syndrome, and Leber's hereditary optic neuropathy

Heteroplasmy is the presence of more than one type of organellar genome (mitochondrial DNA or plastid DNA) within a cell or individual

It is an important factor in considering the severity of mitochondrial diseases.

Phylogeny.............

Phylogeny or or the lineage trace back is vital for genomic interpretations. The evolutionary link tracing is of importance in clinical, historical, and conservation biology. In this context, its important to be well-versed of the robust tools and data formats.

High bootstrap value means, node is well-supported. Bootstrap value of 95% or 0.95 means in 95 out of 100 iterations, the node is supported. A maximum likelihood tree with bootstrap value ~70% and above are considered okay.

Positive or diversifying or disruptive or accelerating selection
Negative or purifying selection

Sequence to analyze for phylogeny........
Molecular sequence (DNA, protein)
Molecular presence (RFLP, isozyme, RAPD, ISSR, AFLP)

Aligner: Blat, gmap
Multiple Alignment: Clustal, MUSCLE, TCoffee
Alignment Refinement: Gblocks
Substitution matrices: BLOSUM, PAM, WAG, JTT, DAYHOFF
Model selection: jModel, GTR (General Time Reversible), GTRCAT, GTRGAMMA, PROTGAMMAJTT
Phylogenetic analysis: MEGA, Mesquite, BioNJ, MrBayes, PAML, PAUP, PhyML, RAxML, SeaView, BEAST
PAML: Phylogenetic Analysis Using Maximum Likelihood
RAxML: Randomized Axelerated Maximum Likelihood (based on maximum likelihood)

RAxML is very popular as its fast and generates maximum likelihood tree with good scores. It accepts phylip format files. 
File formats: Phylip, RAxML, Nexus
Tools and the files they accept:

MEGA:

PAUP: nexus (.nex)

MrBayes: nexus (.nex)
PhyML, RAxML: phylip (.phy)
Others: fasta (.fa)
Phylogenetic tree view (vizualization): SplitsTree, Newick, Drwatree, TreeDyn, FigTree
Phylip: Phylogeny inference package

fasta------------>phylip------------>tree

(http://evolution.genetics.washington.edu/phylip/progs.algs.tree.html)

STEP 1: Code to convert fasta sequence to phylip format (convertFasta2Phylip.sh)........
#! /bin/sh
#The code convert.sh converts fasta sequence to phylip format
#Phylip format is almost same, just the sequences are presented in one line. It has an header mentioning the number/length of sequences (n, m) followed by alignment.
#If the execution is wrong print this statement
if [ $# != 1 ]; then
    echo "USAGE: ./script <fasta-file>"
    exit
fi

#first column should have > symbol. Count no. of >.
numSpec=$(grep -c  ">" $1)

#read field 1; substitute symbols; delete all line numbers; delete space, substitute; substitute
tmp=$(cat $1 | sed "s/>[ ]*\(\w*\).*/;\1</"  | tr -d "\n" | tr -d ' '  | sed 's/^;//' | tr "<" " " )
#find length
length=$(($(echo $tmp | sed 's/[^ ]* \([^;]*\);.*/\1/'   | wc -m ) - 1))

echo "$numSpec $length"
echo  $tmp | tr ";" "\n"
--------------------
 data_file
 >|cow|
ATCGGGGCTGCGTGAAAAAAAAATTGC
>|egret|
AGGGTCCAATGTTAACTTTCATGCGCTCG
>|turtle|
AGGTAAACCGTGAGCGGGCGGGATG
>|rabbit|
TATTGACTGACCCGGGCAATTCGTG
>|goat|
TTGAAAACCCGTGGGTGCGGGGCCCCGGG
--------------------
execution:
sh convert.sh data_file
 --------------------
output
 5 29
ATCGGGGCTGCGTGAAAAAAAAATTGC
 AGGGTCCAATGTTAACTTTCATGCGCTCG
 AGGTAAACCGTGAGCGGGCGGGATG
 TATTGACTGACCCGGGCAATTCGTG
 TTGAAAACCCGTGGGTGCGGGGCCCCGGG
############################################
STEP 2: Code to convert phylip sequence into tree........
# -s (input seq), -n (output_seq), -N (no. of replicates, no. of alignments), -T (threads to run), -f (estimation algorithm), -x(), -m(model), -b(randomizer), -p random seed, -f (rapid Bootstrap analysis and search for best-scoring ML tree in one program run), -m GTRGAMMA     (GTR + Optimization of substitution rates + GAMMA model of rate)
#Have to play with the parameters depending upon requirements
raxml -s phylip.phy -n phylip.raxml.signalTree -m GTRCAT -f a -T 2 -x 1000 -N 300

#Tree from DNA file
raxml-hpc -T 8 -m GTRGAMMA -s file.phylip -f d -n output
raxml-hpc -T 8 -m GTRGAMMA -s file..phylip -x 12345 -N 500 -n output.500rbs

#Single tree from protein file
raxmlHPC -s file.phy -n file.raxml.singleTree -c 4 -f d -m PROTGAMMAJTT

#A set of bootstrap tree from protein file
raxmlHPC -s file.phy -n file.raxml -c 4 -f d -m PROTGAMMAJTT -b 234534251 -N 10
---------------
# Tree from multiple alignment sequences (concatenated core genes, mde by Roary)
raxmlHPC -m GTRGAMMA -p 12345 -s core_gene_alignment.aln -n NAME

# Run RAxML in bootstrap mode
raxmlHPC -m GTRGAMMA -p 12345 -s core_gene_alignment.aln -n NAME_bootstrap -f a -x 12345 -N 100 -T 12
# Results (open with Forester)
RAxML_bestTree.NAME_bootstrap - best-scoring ML tree
RAxML_bipartitions.NAME_bootstrap - best-scoring ML tree with support values
RAxML_bipartitionsBranchLabels.NAME_bootstrap - best-scoring ML tree with support values as branch labels
RAxML_bootstrap.NAME_bootstrap - all bootstrapped trees
RAxML_info.NAME_bootstrap  - program  info

Most recent common ancestor (MCRA)

(https://evolution.berkeley.edu/evolibrary/article/0_0_0/evotrees_primer_04)

Paraphyletic taxon: does not include all the descendants of the most recent common ancestor.
Monophyletic taxon: include all the descendants of the most recent common ancestor.
Probabilistic analysis of a concatenated alignment - are limited by large demands in memory and computing time.
Supertree methods: focuses on the topology or structure of the phylogenetic tree, rather than the evolutionary divergences associated to it. 

Math formulae:.........

Good Math softwares, websites: Matlab, Mathematica, Maple, Symbolab, CAS, Wolfram
PEMDAS: Parenthesis, Exponential, Multiplication, Division, Addition, Subtraction
BODMAS: Brackets, Orders (powers and roots), Division and Multiplication, Addition and Subtraction
Identities(Additive, Associative,Multiplicative, Distributive, Commutative, polynomial)

(a+b)^2 = a^2 + 2ab + b^2
(a+b)(c+d) = ac + ad + bc + bd
#Difference of squares
a^2 - b^2 = (a+b)(a-b)
#Sum and Difference of Cubes
a^3 (+-) b^3 = (a (+-) b)(a^2(-+) ab + b^2)
#Quadratic Formula
ax^2 + bx + c = 0 then x = ( -b (+-)sqrt(b^2 - 4ac) ) / 2a
------------------------------
########Mensuration########
pi = 3.141
#Circle
Circumference = 2Pi r
Area = Pi r^2

Length of arc
    = theta (in degree)  (Pi/180)  r
    = theta (in radian) r

Area of Sector:
= (theta/360) Pi r^2
=((theta/(2Pi)) Pi r^2

#Surface Area formulae
Cube = 6a^2
Cylinder = 2pi r^2 + 2pi rh
Sphere = 4 pi r^2

#Volume formulae
cube = a^3
rectangular prism = abc
cylinder = pi r^2h
cone = (1/3)pi r^2h
sphere = (4/3) pi r^3

########Trigonometry########
sin(q) = opposite / hypotenuse = p/h
cos(q) = base / hypotenuse = b/h
sin(90°) = 1
cos(90°) = 0

Population Genetics............

Population Genetics
This branch of genetics deals with distribution and change in frequency of alleles
Population Genetics is the study of how populations change genetically over time
Microevolution - the change in the genetic makeup of a population from generation to generation
Gene pool: All the genes present in a population at any given time
Allele frequency : How often a particular allele shows up in a population
The Hardy-Weinberg Theorem: If allele frequencies stay the same from one generation to the next, then no evolution is occurring
p2 + 2pq + q2 = 1 Where p2 = frequency of AA genotype 2pq = frequency of Aa genotype q2 = frequency of aa genotype

(https://www.nature.com/scitable/knowledge/library/the-hardy-weinberg-principle-13235724)

H-W equilibrium: 1. The population is very large 2. Mating is random 3. no mutations 4. no migration
Data: SNP, microsattellite
Software: Arlequin, Structure, Populus
Founder effect : A way Nature to randomly create new species from existing populations

Geology..................

Mica is a sheet silicate (phyllosilicate).

Intrusive igneous rocks: diorite, gabbro, granite, pegmatite, and peridotite

Extrusive igneous rocks: andesite, basalt, obsidian, pumice, rhyolite, scoria, and tuff

---------

San Andreas Fault: It occur in between Pacific Plate and the North American Plate. Areas around  it are earthquake-prone. Pacific Plate has San Diego, Los Angeles and Big Sur. North American Plate has San Francisco, Sacramento and the Sierra Nevada.

Scree:  A collection of broken rock fragments at the foot of mountain cliffs or volcanoes. Landforms associated with these materials are often called talus deposits. Animals like marmot and pika live in these habitat.

Embryology, IVF, PGD/PGS.................

Embryology  studies the prenatal development of gametes (sex cells), fertilization, and development of embryos and fetuses

Embryology encompasses the study of congenital disorders that occur before birth, known as teratology.

Through mitosis, the zygote subdivides into blastomeres which contain the full complement of paternal and maternal chromosomes.

After cleavage, the dividing cells, or morula, becomes a hollow ball, or blastula, which develops a hole or pore at one end.
In bilateral animals, the blastula has 2 fates.
In the blastula the first pore (blastopore) becomes the mouth of the animal, it is a protostome;  if the first pore becomes the anus then it is a deuterostome.
The protostomes include most invertebrate animals, such as insects, worms and molluscs, while the deuterostomes include the vertebrates.
In due course, the blastula changes into a more differentiated structure called the gastrula.

(https://www.britannica.com/science/prenatal-development)

The blastocyst has an inner cell mass which  forms the embryo. The outer layer called trophoblast gives rise to the placenta. 

A healthy blastocyst hatches from its outer shell, the zona pellucida between day 5 to day 7 after fertilization. Within 24 hours after hatching, embryo implantation after IVF (or a "natural" pregnancy) begins as the embryo invades into the uterine lining.

Blastocyst is implanted in the uterus, embryogenesis continues with the next stage of gastrulation.The gastrula with its blastopore soon develops three distinct layers of cells (the germ layers) from which all the bodily organs and tissues then develop (histogenesis)

The innermost layer, or endoderm, gives a rise to the digestive organs, the gills, lungs or swim bladder if present, and kidneys or nephrites. The middle layer, or mesoderm, gives rise to the muscles, skeleton if any, and blood system. The outer layer of cells, or ectoderm, gives rise to the nervous system, including the brain, and skin or carapace and hair, bristles, or scales.

(https://en.wikipedia.org/wiki/Human_embryogenesis)

Embryos in many species often appear similar to one another in early developmental stages. The reason for this similarity is because species have a shared evolutionary history. These similarities among species are called homologous structures, which are structures that have the same or similar function and mechanism, having evolved from a common ancestor.

(http://www.biozoomer.com/2011/02/evolution-embryology-evidences.html)

In humans, the term embryo refers to the ball of dividing cells from the moment the zygote implants itself in the uterus wall until the end of the eighth week after conception. Beyond the eighth week after conception (tenth week of pregnancy), the developing human is then called a fetus.

In first trimester screen, the maternal blood is tested (by NIPT or  Non Invasive Prenatal Test) for two normal first-trimester proteins.
Cell free maternal DNA and fetal DNA (placental DNA). Fetal DNA is 10% of all circulating cell-re DNA. Length of DNA is 150-200bp.

Then, an ultrasound is used to look at the nuchal translucency region under the skin behind the baby's neck. This test is done between the 11th and 14th week of pregnancy. Nuchal translucency test uses ultrasound to measure the thickness of the fluid buildup at the back of the developing baby's neck. If this area is thicker than normal, it can be an early sign of Down syndrome, trisomy 18, or cardiac problems.

AFP (alpha-fetoprotein), hCG, and Estriol level are tested.

AFP is a major plasma protein produced by the yolk sac of the fetus. The gene coding for this protein is in the q arm of chromosome 4. It is thought to be the fetal form of serum albumin. AFP binds to copper, nickel, fatty acids and bilirubin  and is found in monomeric, dimeric and trimeric forms.
It binds estradiol to prevent the transport of this hormone across the placenta to the fetus. It prevents the virilization of female fetuses. AFP may protect the fetus from maternal estradiol that would otherwise have a masculinizing effect on the fetus. AFP can tell about neural tube defects.

Nowadays, maternal serum is tested for fetal DNA.

Preimplantation genetic diagnosis/screening (PGD or PGS) is used prior to implantation to help identify genetic defects within embryos. PGD benefits couple at risk for passing on a genetic disease or condition. It prevents certain genetic diseases or disorders from being passed on to the child.

The embryos used in PGD are usually created during the process of in vitro fertilization (IVF).
Egg retrieval and fertilization in a laboratory. Over the next three to five days, the embryos will divide into multiple cells.
PGD steps:
Few cells (which would have become placenta) are micro-surgically removed from the embryos, which are about 5 days developed.
After this cell collection, the embryos are safely frozen. The cells derived by embryo biopsy (for genetic material or DNA) are  placed in a tube.
The embryo is screened for genetic abnormalities. The genetic material is evaluated by PCR, FISH, CGH  (comparative genomic hybridisation) arrays or Next Generation Sequencing (NGS) to determine if the inheritance of a problematic gene is present in each embryo.

 

(https://www.invitra.com/preimplantation-genetic-diagnosis-pgd/)

This process takes at least one full week (time taken is constantly being reduced).
Embryos that are free of genetic problems are kept frozen (frozen embryo transfer). Embryos with problematic genes are destroyed.
If PGD finds that the embryos is free of genetic problems, the embryo(s) will be placed in the uterus (by an IVF procedure), and the wait for implantation and a positive pregnancy test begins.
Embryos with the correct number of chromosomes (euploid embryos)
All women are at risk of producing chromosomally abnormal embryos. As a woman ages, the potential for chromosomally abnormal embryos increases, regardless of the number of embryos produced.
For each embryo tested, PGS results will fall into one of three categories: euploid, aneuploid, or mosaic.
Fertlity clinic: In vitro fertilization with standard insemination, Intracytoplasmic Sperm Injection (ICSI), Assisted Hatching (AHA), embryo cryopreservation, blastocyst culture, TESE () and MESA () for male factor, and embryo biopsy for pre-implantation genetic diagnosis.
GnRH-Agonist is used to suppress the secretion of gonadotropin hormones
Then multiple follicles are recruited by daily injections of gonadotropins. Ultrasound imaging and hormone assessments are used to monitor follicular development
Final maturation of eggs is done by HCG administration
Egg retrieval is scheduled 34-36 hours after HCG injection, in a surgical suite under intravenous sedation
Ovarian follicles are aspirated using a needle guided by trans-vaginal ultrasonography. Follicular fluids are scanned by the embryologist to locate all available eggs. The eggs are placed in a special media and cultured in an incubator until insemination
If sperm parameters are normal, approximately 50,000 to 100,000 motile sperm are transferred to the dish containing the eggs. This is called standard insemination.
ICSI (Intracytoplasmic sperm injection) technique is utilized to fertilize mature eggs if sperm parameters are abnormal
Embryologist picks up a single spermatozoa using a fine glass micro needle and injects it directly into the egg cytoplasm
If there are no sperm in the ejaculate, sperm may be obtained via a surgical procedure
Fertilization is assessed 16-18 hours after insemination or ICSI
The fertilized eggs are called zygotes and are cultured in a specially formulated culture medium that supports their growth
They will be assessed on the second and third day after retrieval
Blastocyst culture has several advantages. Embryos at this stage have a higher potential for implantation, therefore fewer embryos can be transferred on day 5 to reduce the chance of multiple pregnancies. Blastocyst culture makes it possible to select the best one or two blastocysts vs. two or three (or rarely four) early embryos to transfer back to the mother. This reduces the occurrence of potentially risky multiple births Low numbers of embryos and poor embryo quality reduce the chances for good blastocyst development.
Early in the morning on the day of your transfer the embryos are evaluated and photographed by the embryologist
The embryologist will decide based on the rate of development and appearance of the embryos, which and how many embryos are recommended to be transferred.
Typically embryos are transferred at the cleavage stage (4 – 8 cells) (Day 3 after oocyte retrieval) or at the blastocyst stage (a ball of cells with fluid inside)(Day 5)
Embryo transfer is a simple procedure that does not require any anesthesia. Embryos are loaded in a soft catheter and are placed in the uterine cavity through the cervix.
An embryo must hatch out of its outer membrane (zona pellucida) before implanting in the uterine wall (endometrium)
Sometimes the zona is abnormally thick. Laser assisted hatching is a technique that allows a small gap in the zona pellucida to be made. This will aid the embryo in breaking out of this membrane and facilitates implantation
This perforation/ assisted hatching is performed prior to embryo transfer and when doing trophectoderm biopsies
Assisted hatching improves IVF success rates in both fresh embryo transfers and frozen embryo transfers.

(https://emedicine.medscape.com/article/273415-overview)

#Risks of PGS....
Incorrect result
Biopsy stress may cause embryo to arrest growth
Freeze-thaw cycle may be harmful

#Benefits of PGS.......
Beneficial for older woman
Female having repeated miscarriages may be benfittrrd
IVF failure rate may decrease